View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241_low_23 (Length: 298)
Name: NF1241_low_23
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 145 - 205
Target Start/End: Complemental strand, 33717636 - 33717576
Alignment:
| Q |
145 |
cacacaatgtaaacaaattataaaatgtaactaacatagactatttcaaagaatttacaca |
205 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33717636 |
cacaaaatgtaaacaaattataaaatgtaactaacatagactatttcaaagaatttacaca |
33717576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University