View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241_low_27 (Length: 290)
Name: NF1241_low_27
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 979137 - 978853
Alignment:
| Q |
1 |
tctttggctttcctttttgccttttcttcaccttgacccaagattaatcccctcttcttgatttctgaggtttttcctttgcttttgtttgggtccccct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
979137 |
tctttggctttcctttttgccttttcttcaccttgacccaagattaatcttctcttcttgatttttgaggtttttcctttgcttctgtttgggtccacct |
979038 |
T |
|
| Q |
101 |
ggtgctagaatcttttatctcctgggttgttatatgtgtttctttctttcagttgtactctacaagaattattgatttctttatcagagcgtattcacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
979037 |
ggtgctagaatcttttatctcctgggttcttatatgtgtctctttctttcagttgtactctacaagaattattgatttctttatcataatgtattcacct |
978938 |
T |
|
| Q |
201 |
tttctttttctatgtgcttttgtctgttaccctacataaac---cttggtttcttctagatttcatctttctctatattcatctc |
282 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
978937 |
tttctttttctctgtgcttttgtctgttaccctacagaaaccttcttggtttcttctagatttcatttttctctatattcttctc |
978853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University