View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241_low_28 (Length: 275)
Name: NF1241_low_28
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 53 - 242
Target Start/End: Original strand, 37976073 - 37976262
Alignment:
| Q |
53 |
attaactacatatatggaagcgatgtgtgtcaattaaactagatcgaaagctagtggttgatagcatagttaatagctctcatatctaaatcgaatttgg |
152 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37976073 |
attaactacatctatggaagtgatgtgtgtcaattaaactagatcgaaagctagtggttgatagcatagttaatagctctcatatctaaatcgaatttgg |
37976172 |
T |
|
| Q |
153 |
ctagctactatccaaactttaatcatttcaaacaaaaataattatccaaactttgatataagttttgttggcagacaagtgaatattgtt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
37976173 |
ctagctactatccaaactttaatcatttcaaacaaaaataattatccaaactttgatataagttttgctggcagacaagtgaattttgtt |
37976262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University