View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241_low_39 (Length: 251)
Name: NF1241_low_39
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 49671273 - 49671040
Alignment:
| Q |
1 |
caatgagcttgctgtctctatggcaattttcattctgatatgccagggcagtgtgcctggtcttgctagatcaccgtggagatggcaatcaacactgtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
49671273 |
caatgagcttgctgtctctatggcaattttcatcctgatatgccatggcagtgtgcctgatcttgctagattgccgtggagatggcaatcaacagtgtga |
49671174 |
T |
 |
| Q |
101 |
tttgaaacatattcatacacgagcagtagttcattgctgtgatatgaagtacagccatagagggatacaaggtttgtgtggcgcgtgcgagcaaggatct |
200 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||| ||||||||||||||||||| |||||| ||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
49671173 |
tttggaacatattcgtacacgagcagtagttcgttgctgtgatatgaagtactgccataaagggatacaagattcgtgtggcgtgtgcgagcaaggatct |
49671074 |
T |
 |
| Q |
201 |
caatttcatttgtgaactgttctactcgcctcca |
234 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
49671073 |
caatttcattcgtgaactgttctactcgcctcca |
49671040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 184
Target Start/End: Complemental strand, 49675373 - 49675289
Alignment:
| Q |
100 |
atttgaaacatattcatacacgagcagtagttcattgctgtgatatgaagtacagccatagagggatacaaggtttgtgtggcgc |
184 |
Q |
| |
|
|||||||| |||||||| || |||| |||||||| || |||| |||||||||||||||||| || || || ||| |||||||| |
|
|
| T |
49675373 |
atttgaaatgtattcatatacaagcaatagttcatgactatgatgtgaagtacagccatagagagaaactagatttctgtggcgc |
49675289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University