View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241_low_43 (Length: 245)
Name: NF1241_low_43
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241_low_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 221
Target Start/End: Complemental strand, 25483105 - 25482904
Alignment:
| Q |
20 |
atcacatgggaatggatattattgtcgaaggatgaaaatagtttactatcaccgttgctaaataaaagtcaccgttgctaaataaaagacacatttgagt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25483105 |
atcacatgggaatggatattattgtcgaaggatgaaaatagtttactatcaccgttgctaaataaaagtcaccgttgctaaataaaagacacatttgagt |
25483006 |
T |
|
| Q |
120 |
tttctttgtctctatttattgtaactcaacaacatcaccaaacaaacacgaagcacttatgagctataaagtccgactagtacaaaagagagacgtaccc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25483005 |
tttctttgtctctatttattgtaactcaacaacatcaccaaacaaacacgaagcacttatgagctataaagtccgactagtacaaaagagagacgtaccc |
25482906 |
T |
|
| Q |
220 |
gt |
221 |
Q |
| |
|
|| |
|
|
| T |
25482905 |
gt |
25482904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University