View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241_low_46 (Length: 223)
Name: NF1241_low_46
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 75 - 202
Target Start/End: Original strand, 12850481 - 12850608
Alignment:
| Q |
75 |
ccacagatgaggagcttgttgattactaccttaggaagaaaattgcttcaagaaggattgatcttgatgtcataaaagatgttgatctttacaaaattga |
174 |
Q |
| |
|
|||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12850481 |
ccacagatgaagaacttgtggattactaccttaggaagaaaattgcttcaagaaggattgatcttgatgtcataaaagatgttgacctttacaaaattga |
12850580 |
T |
|
| Q |
175 |
accatgggttcttgaaggtataggatat |
202 |
Q |
| |
|
|||||||| ||||||||||||| ||||| |
|
|
| T |
12850581 |
accatgggatcttgaaggtataagatat |
12850608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 89 - 195
Target Start/End: Complemental strand, 42049075 - 42048969
Alignment:
| Q |
89 |
cttgttgattactaccttaggaagaaaattgcttcaagaaggattgatcttgatgtcataaaagatgttgatctttacaaaattgaaccatgggttcttg |
188 |
Q |
| |
|
||||||||||||||||| |||||||| | | || | || ||||||||| |||||||| ||||| |||||||| || |||||||||||||||| |||| |
|
|
| T |
42049075 |
cttgttgattactacctcaggaagaaggtatcgtctaaaaagattgatctcgatgtcatcaaagacgttgatctctataaaattgaaccatgggatcttc |
42048976 |
T |
|
| Q |
189 |
aaggtat |
195 |
Q |
| |
|
||||||| |
|
|
| T |
42048975 |
aaggtat |
42048969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 75 - 162
Target Start/End: Original strand, 3575011 - 3575098
Alignment:
| Q |
75 |
ccacagatgaggagcttgttgattactaccttaggaagaaaattgcttcaagaaggattgatcttgatgtcataaaagatgttgatct |
162 |
Q |
| |
|
|||| ||||| || ||||||||| ||||||||||||| || || ||||| | |||||||||||||||| |||| |||||||||||||| |
|
|
| T |
3575011 |
ccactgatgaagaacttgttgatcactaccttaggaaaaagatagcttctaaaaggattgatcttgatatcattaaagatgttgatct |
3575098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University