View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12420_high_4 (Length: 362)
Name: NF12420_high_4
Description: NF12420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12420_high_4 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 16 - 362
Target Start/End: Original strand, 2941908 - 2942254
Alignment:
| Q |
16 |
tgaatgacataattggaagaaacatgggaaattttaagggacatttctaagttcaaatatatcacagtcatgccgacacattatccacgacgataatcgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2941908 |
tgaatgacataattggaagaaacatgggaaattttaagggacatttctaagttcaaatatatcacagtcatgccgacacattatccacgacaataatcgc |
2942007 |
T |
 |
| Q |
116 |
tcctaagctctgttgtcaacagcggctgctaccggcgcggcgcgtccaaaaccacactattgtgttgcaacgcttcaaggaggatcgtttggggaaagcg |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |||| | || |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2942008 |
tcccaagctctgttgtcaacagcggctgctaccgatgcggagtgttcaaaaccacactattgtgttgcaacgcttcaaggaggagcgtttggggaaagcg |
2942107 |
T |
 |
| Q |
216 |
ggtttcgcgaccgctatctggtggagcagggctgtccaaaagcggatcaaatcggccactttttgggtcgtagcacaaatacaaaattgcccttcactta |
315 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2942108 |
ggtttcgcaaccgctatctggtggagcagggttgtccaaaagcggatcaaatcggccactttttgggtcgtagcacaaatacaaaattgcccttctctta |
2942207 |
T |
 |
| Q |
316 |
aaatcgtttggaggggcaattttgtaacttttgaaaccctaagttac |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2942208 |
aaatcgtttggaggggcaattttgtaacttttgaaaccctaagttac |
2942254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 201 - 265
Target Start/End: Complemental strand, 8341791 - 8341727
Alignment:
| Q |
201 |
cgtttggggaaagcgggtttcgcgaccgctatctggtggagcagggctgtccaaaagcggatcaa |
265 |
Q |
| |
|
||||||| |||||||||||||||| |||||||| |||||||| |||| | |||||||||| |||| |
|
|
| T |
8341791 |
cgtttggagaaagcgggtttcgcggccgctatccggtggagcggggcggaccaaaagcgggtcaa |
8341727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 277 - 340
Target Start/End: Original strand, 36392527 - 36392590
Alignment:
| Q |
277 |
tttgggtcgtagcacaaatacaaaattgcccttcacttaaaatcgtttggaggggcaattttgt |
340 |
Q |
| |
|
|||||||||||| | |||||| | | |||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
36392527 |
tttgggtcgtagtataaatacgagactgcccttcacttaaaaccgtttcgagggtcaattttgt |
36392590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 212 - 247
Target Start/End: Original strand, 13459505 - 13459540
Alignment:
| Q |
212 |
agcgggtttcgcgaccgctatctggtggagcagggc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13459505 |
agcgggtttcgcgaccgctatctggtggagcggggc |
13459540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University