View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12420_low_10 (Length: 226)
Name: NF12420_low_10
Description: NF12420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12420_low_10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 118 - 226
Target Start/End: Original strand, 48485111 - 48485219
Alignment:
| Q |
118 |
ttatataggttctcatatcagaagtcgtttcacttgtgaaccaagccatatttgttaagaattttgtctgcagcatggagaggaaatcaaaatattttaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48485111 |
ttatataggttctcatatcagaagtcgtttcacttgtgaaccaagccatatttgttaagaattttgtctgcagcatggagaggaaatcaaaatattttaa |
48485210 |
T |
|
| Q |
218 |
ttaggctat |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
48485211 |
ttaggctat |
48485219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University