View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12420_low_2 (Length: 530)
Name: NF12420_low_2
Description: NF12420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12420_low_2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 3e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 203 - 416
Target Start/End: Complemental strand, 36726691 - 36726478
Alignment:
| Q |
203 |
ggattttctactttgctttggtgaaaatacatgtttgggaaattccttgcatgctgagttgtctggagccatgagagcaatagagaatgcaaactcacat |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
36726691 |
ggattttctactttgctttggtgaaaatacaggtttgggaaactccttgcatgtcgagttgtctggagccatgagaccaatagagattgcaaactcacat |
36726592 |
T |
|
| Q |
303 |
caatggtcgaatttatggctggaagtagattcaaaattggtgatcaaggccttcaaaaatgtttctttagttccttggaagcttagaaacagatggttaa |
402 |
Q |
| |
|
|| ||||||| ||||||||||||| ||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36726591 |
cagcggtcgaaattatggctggaagcagattcagaattggtgatcaaagccttaaaaaatgtttctttagttccttggaagcttagaaacagatggttaa |
36726492 |
T |
|
| Q |
403 |
actgcgttcaattg |
416 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36726491 |
actgcgttcaattg |
36726478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 101; Significance: 8e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 426 - 530
Target Start/End: Complemental strand, 25276704 - 25276600
Alignment:
| Q |
426 |
gccttctggccactactcactactgagttggcaacttggaaaaacaaagtaaatgccaacataagacaatggttctccaattgcactcgtacgaagcttt |
525 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25276704 |
gccttctggctactactcactactgagttggcaacttggaaaaacaaagtaaatgccaacataagacaatggttctccaattgcactcgtacgaagcttt |
25276605 |
T |
|
| Q |
526 |
tactc |
530 |
Q |
| |
|
||||| |
|
|
| T |
25276604 |
tactc |
25276600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 126 - 196
Target Start/End: Complemental strand, 22830686 - 22830616
Alignment:
| Q |
126 |
tggatcaaatgcaatacagatggattcacaaatggtaatctctcctcttgtggaggaattttcagagatag |
196 |
Q |
| |
|
|||||||||||||| || ||||||| ||||||||| || ||||||| ||||||||||||||| |||||||| |
|
|
| T |
22830686 |
tggatcaaatgcaacaccgatggatccacaaatggcaacctctccttttgtggaggaatttttagagatag |
22830616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 153 - 229
Target Start/End: Original strand, 23881422 - 23881498
Alignment:
| Q |
153 |
acaaatggtaatctctcctcttgtggaggaattttcagagatagtaaatcggattttctactttgctttggtgaaaa |
229 |
Q |
| |
|
|||||| |||||| || || ||||| ||||| |||||||||||||| ||||||||| | ||||||||||| ||||| |
|
|
| T |
23881422 |
acaaatagtaatcaatcttcctgtgggggaatcttcagagatagtaattcggattttttgctttgctttggagaaaa |
23881498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 132 - 196
Target Start/End: Original strand, 17688922 - 17688986
Alignment:
| Q |
132 |
aaatgcaatacagatggattcacaaatggtaatctc-tcctcttgtggaggaattttcagagatag |
196 |
Q |
| |
|
||||||||||| ||||| | ||||||||||| |||| ||||| |||||||| |||||||||||||| |
|
|
| T |
17688922 |
aaatgcaatactgatggctccacaaatggta-tctcatcctcatgtggagggattttcagagatag |
17688986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 132 - 196
Target Start/End: Original strand, 23113677 - 23113741
Alignment:
| Q |
132 |
aaatgcaatacagatggattcacaaatggtaatctc-tcctcttgtggaggaattttcagagatag |
196 |
Q |
| |
|
||||||||||| ||||| | ||||||||||| |||| ||||| |||||||| |||||||||||||| |
|
|
| T |
23113677 |
aaatgcaatactgatggctccacaaatggta-tctcatcctcatgtggagggattttcagagatag |
23113741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University