View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12421_low_1 (Length: 408)
Name: NF12421_low_1
Description: NF12421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12421_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 1e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 201 - 406
Target Start/End: Original strand, 41530960 - 41531166
Alignment:
| Q |
201 |
cggtacattcaaaatcagcattaatcaatttgaaacatgacaatgcaggttaaatgataagctgtgatgggacnnnnnnn-ttatgtccaagaattttga |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
41530960 |
cggtacattcaaaatcagcattaatcaatttgaaacatgacaatgcaggttaaatgataagctgtgataggacaaaaaaaattatgtccaagaattttga |
41531059 |
T |
|
| Q |
300 |
tggagtttgtgcttacaagtgtaggcttggaaaatatatgccttccacaccattgcagagaacattgaccttatttgaaagcactaactgctcacaggtt |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
41531060 |
tggagtttgtgcttacaagtgtaggcttggaaaatatatgccttccacaccattgcagagaacattgaccttatttgaaagcactaactgctcactgttt |
41531159 |
T |
|
| Q |
400 |
ctgctcg |
406 |
Q |
| |
|
||||||| |
|
|
| T |
41531160 |
ctgctcg |
41531166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 41530767 - 41530840
Alignment:
| Q |
8 |
gaacctgtgtgtcgttcccattcactaagcgcttgcttttctgtcccacaaaaaccacacttgcacacaactct |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41530767 |
gaacctgtgtgtcgttcccattcactaagcgcttgcttttctgtcccacaaaaaccacacttgcacacaactct |
41530840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 292 - 388
Target Start/End: Complemental strand, 15626219 - 15626123
Alignment:
| Q |
292 |
aattttgatggagtttgtgcttacaagtgtaggcttggaaaatatatgccttccacaccattgcagagaacattgaccttatttgaaagcactaact |
388 |
Q |
| |
|
|||||||| |||||| |||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||| |||| ||| ||||||| |
|
|
| T |
15626219 |
aattttgaatgagtttatgcttacaagtgaaggcttggaaaatatatgccttccacactattgcagagaacagtgaccttctttggaagtactaact |
15626123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 301 - 385
Target Start/End: Complemental strand, 816656 - 816572
Alignment:
| Q |
301 |
ggagtttgtgcttacaagtgtaggcttggaaaatatatgccttccacaccattgcagagaacattgaccttatttgaaagcacta |
385 |
Q |
| |
|
||||||| |||||||||||| || | ||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||| |
|
|
| T |
816656 |
ggagtttatgcttacaagtgaagacatggaaaatatatgccttccacaccattgcagagaacagtgaccttctttggaagcacta |
816572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 8 - 81
Target Start/End: Complemental strand, 817448 - 817375
Alignment:
| Q |
8 |
gaacctgtgtgtcgttcccattcactaagcgcttgcttttctgtcccacaaaaaccacacttgcacacaactct |
81 |
Q |
| |
|
||||||||||| ||||||||||||||||| || || ||||| |||||||||||| |||||||||||| |||||| |
|
|
| T |
817448 |
gaacctgtgtggcgttcccattcactaagtgcctgtttttcagtcccacaaaaatcacacttgcacataactct |
817375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University