View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12422_high_9 (Length: 307)
Name: NF12422_high_9
Description: NF12422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12422_high_9 |
 | |
|
| [»] scaffold0039 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0039 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 20 - 287
Target Start/End: Complemental strand, 110174 - 109908
Alignment:
| Q |
20 |
atagatacggagaactagcaacataagaccgaatttagttatatgaggaggatcatatggtttccaaatttttcctccaccagattgcaacacattcacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
110174 |
atagatacggagaactagcaacataagaccgaatttcgttatatgaggaggataatatggtttccaaatttttcctccaccagattgcaacacattcacc |
110075 |
T |
|
| Q |
120 |
tacgtgcatgatgaagaggagaagtctgtaaggatgcaggttggttaaaaacatgaatttgtgagaactttgaataaaagacaagtctactgatagctac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
110074 |
tacgtgcatgatgaagaggagaagtctgtaaggatgaaggttggttaaaaacgtgaatttgtgagaactttgaat-aaagacaagtctactgatagctac |
109976 |
T |
|
| Q |
220 |
acaactctttctttacttaattcttgatgtttattctcttgattcaacattacacaaagaacaaacgg |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
109975 |
acaactctttctttacttaattcttgatgtttattctcttgattcaacattacacaaagaacaaacgg |
109908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 79 - 121
Target Start/End: Original strand, 45614392 - 45614434
Alignment:
| Q |
79 |
gtttccaaatttttcctccaccagattgcaacacattcaccta |
121 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45614392 |
gtttcaaaatttggcctccaccagattgcaacacattcaccta |
45614434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University