View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12424_high_8 (Length: 234)
Name: NF12424_high_8
Description: NF12424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12424_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 8 - 216
Target Start/End: Original strand, 42214960 - 42215168
Alignment:
| Q |
8 |
gcagaacctgtgtttgtatcagaactcaatttctggttcaattccacctcaaattggtgagctcagaaagcttcagagtctacttttatggcaaaacaat |
107 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42214960 |
gcagaatctgtatttgtatcagaactcaatttctggttcaattccacctcaaattggtgagctcagaaagcttcagagtctacttttatggcaaaacaat |
42215059 |
T |
 |
| Q |
108 |
atggtaggagcaattccagaagagcttggaaactgcagagagctcagtgagatagatttgtcagaaaatcttctcacaggtagcataccaatcagttttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42215060 |
atggtaggagcaattccagaagagcttggaaactgcagagagctcagtgagatagatttgtcagaaaatcttctcacaggtagcataccaatcagttttg |
42215159 |
T |
 |
| Q |
208 |
gaaagctat |
216 |
Q |
| |
|
||||||||| |
|
|
| T |
42215160 |
gaaagctat |
42215168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 196
Target Start/End: Original strand, 24156393 - 24156569
Alignment:
| Q |
20 |
tttgtatcagaactcaatttctggttcaattccacctcaaattggtgagctcagaaagcttcagagtctacttttatggcaaaacaatatggtaggagca |
119 |
Q |
| |
|
||||||||||||||| | || |||||||||||| |||||||||| | || | ||||| ||||| ||||| ||||||| |||||| | ||||| | |
|
|
| T |
24156393 |
tttgtatcagaactctctctcaggttcaattccagctcaaattggaaaccttaacaagctgaagagtttacttctatggcagaacaatttagtaggtact |
24156492 |
T |
 |
| Q |
120 |
attccagaagagcttggaaactgcagagagctcagtgagatagatttgtcagaaaatcttctcacaggtagcatacc |
196 |
Q |
| |
|
|||||||||||| |||||| ||||||||| | |||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
24156493 |
attccagaagagattggaagatgcagagagattcaacttatagatttttcagaaaatcttttaacaggtagcatacc |
24156569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University