View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12424_high_9 (Length: 216)

Name: NF12424_high_9
Description: NF12424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12424_high_9
NF12424_high_9
[»] chr3 (1 HSPs)
chr3 (19-199)||(39394368-39394548)


Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 39394548 - 39394368
Alignment:
19 attcttttcttttttccaattctgcctctgattcttgaagtttcctcttgtactcagacaacaaatcatctttctccgacaattgttgttcatgttttaa 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
39394548 attcttttcttttttccaattctgcctctgattcttgaagtttcctcttgtactcagacaacaaaacatctttctccgacaattgttgttcatgttttaa 39394449  T
119 tgatatttcactatggttgttttttggttctgaaaccttctttgcggcaattacttcatcaatcatgtcattggttttctc 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39394448 tgatatttcactatggttgttttttggttctgaaaccttctttgcggcaattacttcatcaatcatgtcattggttttctc 39394368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University