View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12426_low_5 (Length: 337)
Name: NF12426_low_5
Description: NF12426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12426_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 21 - 321
Target Start/End: Original strand, 27421669 - 27421978
Alignment:
| Q |
21 |
gttaacgccttaaactgctaaaagttcatgttctcttgtacgggaaattgtaatctcaaaaaatataataagcatagatcaccttttttcttgtaccatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27421669 |
gttaacgccttaaactgctaaaagttcatgttctctcgtacgggaaattgtaatctcaaaaaatttaataagcatagatcaccttttttcttgtaccatt |
27421768 |
T |
|
| Q |
121 |
acctacctcggcaaattaaattaagcacaccttttctcaaacggtggtagacaaacgcaaaacacacctaacttgttttctacgttattgtgagcaacgc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27421769 |
acctacctcggcaaattaaattaagcacaccttttctcaaacggtggtagacaaacgcaaaacacacctaacttgttttctacgttattgtgagcaacgc |
27421868 |
T |
|
| Q |
221 |
cattctcttttttggtaacctaatttggtg------------cctcgagtgatgacacaacacaatgctctttgaactctcttagtagtatgccatggtt |
308 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||||||| |||| ||||||||||||||| |
|
|
| T |
27421869 |
cattctcttttttggtaacctaatttgttgcactcttctctacctcgagtgatgacacaacactatgctctttgaaccctct---tagtatgccatggtt |
27421965 |
T |
|
| Q |
309 |
cgatacattctct |
321 |
Q |
| |
|
||||||||||||| |
|
|
| T |
27421966 |
cgatacattctct |
27421978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University