View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12427_high_6 (Length: 299)
Name: NF12427_high_6
Description: NF12427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12427_high_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 23 - 299
Target Start/End: Complemental strand, 45566038 - 45565762
Alignment:
| Q |
23 |
gggatgagttagatagatttaggggcagcgtgcaagcttcccaaattgggcgctctaaggaggtacatatttgaatgggaggattattggcacaagcaga |
122 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45566038 |
gggatgagttagagagatttaggggcagcgtgcaagcttcccaaattgcgcgctctaaggaggtacatatttgaatgagaggattattggcacaagcaga |
45565939 |
T |
 |
| Q |
123 |
agcattttggaaacaaatagcaaaggtgatttggcttaaggatggtgacaccaatgcgcgattctttcaagccatggcgagtgcaaagagatgatgcaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565938 |
agcattttggaaacaaatagcaaaggtgatttggcttaaggatggtgataccaatgcgcgattctttcaagccatggcgagtgcaaagagatgatgcaat |
45565839 |
T |
 |
| Q |
223 |
acttttacaaacttgaagaaagatgataggactttggttgtggcgcaacatgaactttacgtggttgctagctccta |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565838 |
acttttacaaacttgaagaaagatgataggactttggttgtggcgcaacatgaactttacgtggttgctagctccta |
45565762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 8179449 - 8179388
Alignment:
| Q |
109 |
ttggcacaagcagaagcattttggaaacaaatagcaaaggtgatttggcttaaggatggtga |
170 |
Q |
| |
|
|||||||||| |||||| |||||||| |||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
8179449 |
ttggcacaagaagaagcgttttggaagcaaagagctaaggtgatttggctgaaggatggtga |
8179388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University