View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12427_low_6 (Length: 321)
Name: NF12427_low_6
Description: NF12427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12427_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 212 - 303
Target Start/End: Original strand, 45386947 - 45387038
Alignment:
| Q |
212 |
gttatcattaaaaacctctcccatggcttcaagtttcacaaaaggaatctgcctctaagataagcttcgtgcaactatcacttatgccgtct |
303 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45386947 |
gttatcattagaaacctctcccatggcttcaagtttcacaaaaggaatctgcctctaagataagcttcgtgcaactatcacttatgccgtct |
45387038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University