View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12428_low_3 (Length: 336)
Name: NF12428_low_3
Description: NF12428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12428_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 15 - 321
Target Start/End: Complemental strand, 1965053 - 1964747
Alignment:
| Q |
15 |
tgctcttctaaacacttgtgacgacgccttagccaaacgaggtgttgaattacaaccatccaaggcaatgccaatggtaaccccatttaactgtgtagga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1965053 |
tgctcttctaaacacttgtgacgacgccttagcaaaacgaggtgttgaattacaaccatccaaggcaatgccaatggtaaccccatttaactgtgtagga |
1964954 |
T |
 |
| Q |
115 |
gcaactagttgcactgaagatttattccactcactgtccttttcaaattcttcaactttttctttctttgatgagtattttgagcaaatgcaccccatct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1964953 |
gcaactagttgcactgaagatttattccactcactttccttttcaaattcttcaactttttctttctttgatgagtattttgagcaaatgcaccccatct |
1964854 |
T |
 |
| Q |
215 |
tagtgtttatttcaatcaaaaatatgtatatcactacccacccttttgtgaaatttaattaatcgttgttacaattgaatttttcttgggaacccaaaag |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1964853 |
tagtgtttatttcaatcaaaaatatgtatatcactacccacccttttgtgaaatttaattaatcgttgttacaattgaatttttcttgggaacccaaaag |
1964754 |
T |
 |
| Q |
315 |
ctcccac |
321 |
Q |
| |
|
||||||| |
|
|
| T |
1964753 |
ctcccac |
1964747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University