View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12429_high_7 (Length: 308)

Name: NF12429_high_7
Description: NF12429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12429_high_7
NF12429_high_7
[»] chr1 (2 HSPs)
chr1 (18-183)||(11358060-11358224)
chr1 (251-296)||(11357947-11357992)


Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 11358224 - 11358060
Alignment:
18 cgcaactaggtgcatttcaaattgatagtttattgaaggaaaaaagaacaaattactctaaaacatggcatgttacatgtatataacaacaacaaaaaat 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
11358224 cgcaactaggtgcatttcaaattgatagtttattgaaggaaaaaagaacaaattactctaaaacatggcatgttacatgtatataa-aacaacaaaaaat 11358126  T
118 cagaaactattctgatggtgtagctcagtggattaacnnnnnnnccatgtctaggtttgatccatc 183  Q
    |||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||    
11358125 cagaaactattctgatggtgtagctcagtggattaacaaaaaaaccatgtctaggtttgatccatc 11358060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 251 - 296
Target Start/End: Complemental strand, 11357992 - 11357947
Alignment:
251 ctatacccaaatggccacgcttagctgcaacatgaaatgcattcat 296  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||    
11357992 ctatacccaaatggccacgcttagctgcaacgtgaaatgcattcat 11357947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University