View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12429_high_8 (Length: 302)
Name: NF12429_high_8
Description: NF12429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12429_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 11 - 180
Target Start/End: Original strand, 11358234 - 11358388
Alignment:
| Q |
11 |
ttatactgcgagcctttatattgcggaaaaatgtggctgattccgtccaaattgatgttgcgatatcgtttcacagacctaatgattgtgtatattgcgc |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
11358234 |
ttatgctgcgagcctttatattgcggaaaaatgtggctgattcggtccaaattgatgttgcgatatcgtttcacagacctaatgattatttat------- |
11358326 |
T |
|
| Q |
111 |
tcctctcaattgcggttagggactacgatttttcaaaatcatgtgatcagttattctacttgaatcatga |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11358327 |
--------attgcggttagggactacgatttttcaaaatcatgtgattagttattctacttgaatcatga |
11358388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 229 - 302
Target Start/End: Original strand, 11358489 - 11358562
Alignment:
| Q |
229 |
atttaggatggtagccgcagtttgataataattcacaaggtctcacataacaggtcctacaaaagtgaaatatc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11358489 |
atttaggatggtagccgcagtttgataataattcacaaggtctcacataacaggtcctacaaaagtgaaatatc |
11358562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 189 - 228
Target Start/End: Original strand, 11358424 - 11358463
Alignment:
| Q |
189 |
ccttctctttttatgaccctgccatgaatgaaataggtat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11358424 |
ccttctctttttatgaccctgccatgaatgaaataggtat |
11358463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University