View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_high_103 (Length: 252)
Name: NF1242_high_103
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_high_103 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 124 - 242
Target Start/End: Complemental strand, 30411440 - 30411322
Alignment:
| Q |
124 |
tttctgatgcaaaagatagaaagtttgtcgatttttcaccaataagaagcatagctgagagaaggggtttcaataaaatcaacgcagggcttatcagttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
30411440 |
tttctgatgcaaaagatagaaagtttgtcgatttttcaccaaaaagaagcatagctgagagaaggggtttcaataaaataaacgcagggcttataagttt |
30411341 |
T |
 |
| Q |
224 |
cggtgcaacaacccctttg |
242 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30411340 |
cggtgcaacaacccctttg |
30411322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 211
Target Start/End: Complemental strand, 30399121 - 30399033
Alignment:
| Q |
123 |
gtttctgatgcaaaagatagaaagtttgtcgatttttcaccaataagaagcatagctgagagaaggggtttcaataaaatcaacgcagg |
211 |
Q |
| |
|
|||||| || ||||||| |||| ||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30399121 |
gtttcttattcaaaagaaggaaacttttttgatttttcaccaaaaagaagcatagctgagagaaggggtttcaataaaatcaacacagg |
30399033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University