View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_high_113 (Length: 248)
Name: NF1242_high_113
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_high_113 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 6032641 - 6032403
Alignment:
| Q |
1 |
tcatgatcaaaactagcttccttagggatcaaattagtgttttgttgataatgatgagaagaagatttcttcaactttctcttaatcacaatagattcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032641 |
tcatgatcaaaactagcttccttagggatcaaattagtgttttgttgataatgatgagaagaagatttcttcaactttctcttaatcacaatagattcct |
6032542 |
T |
 |
| Q |
101 |
caatgaagttaaagatatcatctctttgaagtgattttgaagtttcatcttcattaggcatcaattgatgaaggatttgttgattttgatcaatttcagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032541 |
caatgaagttaaagatatcatctctttgaagtgattttgaagtttcatcttcattaggcatcaattgatgaaggatttgttgattttgatcaatttcagg |
6032442 |
T |
 |
| Q |
201 |
atatttttctttcaaatcttcttgcatcttcatctcact |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032441 |
atatttttctttcaaatcttcttgcatcttcatctcact |
6032403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University