View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_high_114 (Length: 244)
Name: NF1242_high_114
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_high_114 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 123 - 234
Target Start/End: Original strand, 48669127 - 48669238
Alignment:
| Q |
123 |
tattctgctgttccaactatggctactaacgaaggtgacatgttctcagcagagattgtgaaccgtgggattgaatcatcgggtctgaacgccggttcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48669127 |
tattctgctgttccaactatggctactaacgaaggtgacatgttctcagcagagattgtgaaccgtgggattgaatcatcgggtccgaacgccggttcat |
48669226 |
T |
|
| Q |
223 |
tgacgttctctg |
234 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48669227 |
tgacgttctctg |
48669238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 48669005 - 48669045
Alignment:
| Q |
1 |
tttccacccaccttatgtaaaatcaatttcatggatttcat |
41 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48669005 |
tttccacccacctcatgtaaaatcaatttcatggatttcat |
48669045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University