View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_high_118 (Length: 231)
Name: NF1242_high_118
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_high_118 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 156 - 214
Target Start/End: Original strand, 32672431 - 32672490
Alignment:
| Q |
156 |
gaacagacaa-tattctccaccatcaacttacggtctgaatcgagttatagagaatatat |
214 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32672431 |
gaacagacaaatattctccaccatcaacttacggtctgaatcgagttatagagaatatat |
32672490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University