View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1242_high_118 (Length: 231)

Name: NF1242_high_118
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1242_high_118
NF1242_high_118
[»] chr4 (1 HSPs)
chr4 (156-214)||(32672431-32672490)


Alignment Details
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 156 - 214
Target Start/End: Original strand, 32672431 - 32672490
Alignment:
156 gaacagacaa-tattctccaccatcaacttacggtctgaatcgagttatagagaatatat 214  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
32672431 gaacagacaaatattctccaccatcaacttacggtctgaatcgagttatagagaatatat 32672490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University