View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_high_123 (Length: 220)
Name: NF1242_high_123
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_high_123 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 75 - 191
Target Start/End: Original strand, 9716309 - 9716425
Alignment:
| Q |
75 |
tcgagagtaattaaaagcacaagatgcaagaatggaagatgcttagagttaaacgagggaatgaagaagatgatattagttaatcatgtttacccttgat |
174 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
9716309 |
tcgagagtaattaaaagcataagatacaagaatggaagatgcttagagttaaacgagagaatgaagaacatgatattagttaatcatgtttacccttaat |
9716408 |
T |
 |
| Q |
175 |
gtccatcatggacttag |
191 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9716409 |
gtccatcatggacttag |
9716425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University