View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_high_30 (Length: 389)
Name: NF1242_high_30
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 244 - 376
Target Start/End: Original strand, 1270673 - 1270805
Alignment:
| Q |
244 |
gataggtacactgcaaggacgttgtagtagaacatggagatgtatccaaagctttaattgaatatacttctcaatcagcaattgagcatttggttctagg |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1270673 |
gataggtacactgcaaggacgttgtagtagaacatggagatgtatgcaaagctttaattgaatatacttctcaatcagcaattgagcatttggttctagg |
1270772 |
T |
|
| Q |
344 |
ctgttccaacaaaaatggttttctcaagtattc |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1270773 |
ctgttccaacaaaaatggttttctcaagtattc |
1270805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 94 - 160
Target Start/End: Original strand, 1270523 - 1270589
Alignment:
| Q |
94 |
catatcgtgtcttttgtgcgcgaaaagatgtaagtttcacnnnnnnnccaggatagaaaacaagagg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1270523 |
catatcgtgtcttttgtgcgcgaaaagatgtaagtttcacttttttcccaggatagaaaacaagagg |
1270589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University