View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_high_53 (Length: 322)
Name: NF1242_high_53
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_high_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 16 - 295
Target Start/End: Complemental strand, 2413398 - 2413119
Alignment:
| Q |
16 |
atgaaagaagcaagagctgcaattcgccacgcgacagattatctcctcaaatgtgcaacatcaacacctggaagactctatgttggtgttggagatccaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2413398 |
atgaaagaagcaagagctgcaattcgccacgcgacagattatctcctcaaatgtgcaacatcaacacctggaagactctatgttggtgttggagatccaa |
2413299 |
T |
 |
| Q |
116 |
atgttgatcacaaatgttgggaaagaccagaagatatggacactgttagaactgtttattacgtatcttcaaagaatcctggttctgatgttgccgctga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2413298 |
atgttgatcacaaatgttgggaaagaccagaagatatggacactgttagaactgtttatttcgtatcttcaaagaatcccggttctgatgttgccgctga |
2413199 |
T |
 |
| Q |
216 |
aaccgctgctgcacttgctgcggcgtctattgtttttagaaaagttgatccaacttattctaagcttttgttgaggactg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2413198 |
aaccgctgctgcacttgctgcggcgtctattgtttttagaaaagttgatccaacttattctaagcttttgttgaggactg |
2413119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University