View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_high_98 (Length: 256)
Name: NF1242_high_98
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_high_98 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 107 - 248
Target Start/End: Complemental strand, 13312253 - 13312112
Alignment:
| Q |
107 |
ctgcatgttgtcaccatattcacagaaccatcagttatatatcccagttgggaaaatgacaatgacagttgataatctgtcttgtctgtggcatctacca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| || |
|
|
| T |
13312253 |
ctgcatgttgtcaccatattcacagaaccatcagttatatatcccagttgggaaaatgacaatgacagttgataatgtgtctcgtctgtggcatctatca |
13312154 |
T |
 |
| Q |
207 |
atccatgtctgtgatctggacaaaaactggcggagtaaattt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13312153 |
atccatgtctgtgatctggacaaaaactggcggagtaaattt |
13312112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 23 - 112
Target Start/End: Complemental strand, 13312407 - 13312318
Alignment:
| Q |
23 |
atcatcattataaagactctaaaagaaggatggttcacaaacgcaattacaaatagtgcacacgagctattgctaatttgatcactgcat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
13312407 |
atcatcattataaagactctaaaagaaggatggttcacaaacgcaattacaaatagtgcacacaagctattactaatttgatcactgcat |
13312318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University