View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_104 (Length: 276)
Name: NF1242_low_104
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_104 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 30 - 244
Target Start/End: Original strand, 20270037 - 20270251
Alignment:
| Q |
30 |
gagaagcaaaggtacacgacatatccacaagccgagtagtatgacaagcaccgtgagtagtccccacccccactgaaatgggcattggatccccctcacc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20270037 |
gagaagcaaaggtacacgacatatccacaagccgagtagtatgacaagcaccgtgagtagtccccacccccaccaaaatgggcattggatccccctcacc |
20270136 |
T |
 |
| Q |
130 |
gtgcacaagagcattagagaaagaagtggaagtcatacttggccccccgaaggagacaaacgaagatctgccacaccatgccttcccggagagtccctcg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20270137 |
gtgcacaagagcattagagaaagaagtggaagtcatacttgtccccccgaaggagacagacgaagatccgccacaccatgccttcccggagagtccctcg |
20270236 |
T |
 |
| Q |
230 |
agctccccctatgct |
244 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
20270237 |
agctccccctatgct |
20270251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University