View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_105 (Length: 275)
Name: NF1242_low_105
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_105 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 43 - 238
Target Start/End: Complemental strand, 31308923 - 31308728
Alignment:
| Q |
43 |
ggttgaagctaccatggaattggaatggaagaataattgagagaatagtgaaaggagaaagtcgacggaagcatgggttgtgattggaatgacccggaat |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31308923 |
ggttgaagctaccatggaattggaatggaagaataattgagagaatagtgaaaggggaaagtcgacggaagcatggggtgtgattggaatgacccggaat |
31308824 |
T |
|
| Q |
143 |
tgtagttgtagtggccagtgagaattttagaannnnnnnnnnnnnattaattaattaatattctcccaacctttcaaaagaaggaataaatggcct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31308823 |
tgtagttgtagtggccagtgagaattttagaatattttattttttattaattaattaatattctcccaacctttcaaaagaaggaataaatggcct |
31308728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University