View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_108 (Length: 271)
Name: NF1242_low_108
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_108 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 39 - 242
Target Start/End: Original strand, 1300745 - 1300948
Alignment:
| Q |
39 |
tagctattcgagggtaatccttctaagattgttaagaatggtgcctctttcggatggagaagatgcatgtggtcaaccagattatgtgtagatgtaacac |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1300745 |
tagctattcgagggtaatccttctaagattgttaagaatggtgcctctttcggatggagaagatgcatgtggtcaaccagataatgtgtagatgtaacac |
1300844 |
T |
|
| Q |
139 |
gtgcctcctaaaaagagtacttaaattgaccagatgaaaatttaagattgattttaagttttctagatgtatttatgtgaataaaatacacgttaaaaga |
238 |
Q |
| |
|
||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1300845 |
gtgcctccttaaaagaggacttaaattgaccggatgaaaatttaagattgattttaagttttctagatgtatttatgtgaataaaatacacgttaaaaga |
1300944 |
T |
|
| Q |
239 |
gaat |
242 |
Q |
| |
|
|||| |
|
|
| T |
1300945 |
gaat |
1300948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University