View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_115 (Length: 266)
Name: NF1242_low_115
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_115 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 29 - 250
Target Start/End: Original strand, 7704917 - 7705138
Alignment:
| Q |
29 |
attacggatgtctcatgatcactaagtatcctacgacgatattgttacgaattaggttttgttcattctattcccctgttcaaaggttttagtttccttt |
128 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7704917 |
attagggatgtctcatgatccctaagtatcctacgacgatattgttacgaattaggttttgttcattctattcccctgttcaaaggttttagtttccttt |
7705016 |
T |
|
| Q |
129 |
cattctatttcatctgaattcgatgatgaattcttttttgaaattttgcttatctatagttactttgctggacaacatcattgaacattttctcagaact |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7705017 |
cattctatttcatctgaattcgatgatgaattcttttttgaaattttgcttatctatagttactttgctggacaacatcattgaacattttctcagaact |
7705116 |
T |
|
| Q |
229 |
ttttacttactgaacagtgcca |
250 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7705117 |
ttttacttactgaacagtgcca |
7705138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University