View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_118 (Length: 263)
Name: NF1242_low_118
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_118 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 20 - 234
Target Start/End: Original strand, 25266505 - 25266718
Alignment:
| Q |
20 |
aatataatccatttacaaagttcaccttgttaggaaggataaccttataccctacaaattctttaatttccaccaatcactttcttttatgaagtggatt |
119 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25266505 |
aatataatccatctacaaagttcac-ttgttaggaaggataaccttataccctacaaattctttaatttccaccaaacactttcttttatgaagtggatt |
25266603 |
T |
 |
| Q |
120 |
ctacgaattgtcactaactttatgagaagttcaaaaggcaagatcttaaatttcattctgatttggaagagccactaatttcagaatctgtttggtagta |
219 |
Q |
| |
|
||||||||| | || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25266604 |
ctacgaattcttaccaactttatgagaagttcaaaagggaagatcttaaatttcattctgatttggaagagccactaatttcagaatctgtttggtagta |
25266703 |
T |
 |
| Q |
220 |
cacaatatcaccagt |
234 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
25266704 |
cactatatcaccagt |
25266718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University