View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_137 (Length: 252)
Name: NF1242_low_137
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_137 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 30 - 252
Target Start/End: Complemental strand, 38533449 - 38533227
Alignment:
| Q |
30 |
ccaagaatacaacccaaaacgagagaaactccactcattcctctcaaatttttgttctcacttccttcaatattctttgaattaggcacggagaagctgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38533449 |
ccaagaatacaacccaaaacgagagaaactccactcattcctctcaaatttttgttctcacttccttcaatattctttgaattaggcacggagaagctgt |
38533350 |
T |
|
| Q |
130 |
tgttaatcatgcaatttgcatgcccaaatgaacgtgcaaattggtggcttgcggaaaattgagggaaattaagagtggcatggttaaatttgagatgaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38533349 |
tgttaatcatgcaatttgcatgcccaaatgaacgtgcaaattggtggcttgcggaaaattgagggaaattaagagtggcatggttaaatttgagatgaaa |
38533250 |
T |
|
| Q |
230 |
tttgcttcccctagcacttgcat |
252 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38533249 |
tttgcttcccctagcacttgcat |
38533227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University