View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_142 (Length: 251)
Name: NF1242_low_142
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_142 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 38520720 - 38520943
Alignment:
| Q |
1 |
aacgatagtagttataatttgggtcaccctttgttatatctagcctactagagtatgtagaatttcacattctttcattaaataggttgttaaaaccatg |
100 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38520720 |
aacgatagtagatataatttcggtcaccctttattatatctagcctactagagtatgtagaatttcacattctttcattaaataggttgttaaaaccatg |
38520819 |
T |
 |
| Q |
101 |
tttctattcatcttttatacccttttcctgaaccaaaactttttcttctttatcctttatacattttcacttgatccaagtcttttgtcttactttttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38520820 |
tttctattcatcttttatacccttttcctgaaccaaaactttttcttctttatcctttatacattttcacttgatccaagtcttttgtcttactttttgg |
38520919 |
T |
 |
| Q |
201 |
ccctttagcaaacgtatgtataga |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38520920 |
ccctttagcaaacgtatgtataga |
38520943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University