View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_144 (Length: 251)
Name: NF1242_low_144
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_144 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 41263252 - 41263014
Alignment:
| Q |
1 |
cctgtgctagccaacgaactatttcaatgtgaattgtcagataacgacgttcattcacaagctcttagcccagatatgaaaaagttaaagaaagccaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263252 |
cctgtgctagccaacgaactatttcaatgtgagttgtcagataacgacgttcgttcacaagctcttagcccagatatgaaaaagttaaagaaagccaatg |
41263153 |
T |
 |
| Q |
101 |
cagcactagacaattccctaagccaagctcatacactacttcaaatacaatgtgctgatcacaagggtcttctttatgacattatgagaactttgaaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263152 |
cagcactagacaattccctaagccaagctcatacactacttcaaatacaatgtgctgatcacaagggtcttctttatgacattatgagaactttgaaaga |
41263053 |
T |
 |
| Q |
201 |
catgaattttaaggtatagtttttctttattatcagaat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263052 |
catgaattttaaggtatagtttttctttattatcagaat |
41263014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 41301011 - 41301055
Alignment:
| Q |
157 |
gatcacaagggtcttctttatgacattatgagaactttgaaagac |
201 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
41301011 |
gatcacaaaggtcttctttatgacatcatgagaactctgaaagac |
41301055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University