View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_153 (Length: 242)
Name: NF1242_low_153
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_153 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 16102610 - 16102450
Alignment:
| Q |
15 |
aatgaccatatataacttgaccatcacgctaagaaaaatctatatataatcattcaactcatttcttgcaaaaatttggtttactacatcccttaagctt |
114 |
Q |
| |
|
|||||||| ||||||||| ||||||| |||||||| |||| || |||||||||||||||||||||||| | | ||||||||| ||||||| ||| |
|
|
| T |
16102610 |
aatgaccaaatataacttcaccatcatgctaagaataatcaatgtataatcattcaactcatttcttgtgagggtcctgtttactacctcccttacactt |
16102511 |
T |
 |
| Q |
115 |
ttgttgcctaatatgacgtgtcacgctcgaaatctccacaaaatatcactattagatccaa |
175 |
Q |
| |
|
||||||||||| | | ||| || |||||||| |||| |||| || ||| ||||||||||| |
|
|
| T |
16102510 |
gtgttgcctaatctaaagtgccaagctcgaaacctccgcaaagtaacacaattagatccaa |
16102450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 14655969 - 14655918
Alignment:
| Q |
169 |
gatccaattgagtattcccttaatcattttagtgaaccacttgaaacacatct |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14655969 |
gatccaattgagtattcccttaatca-tttagtgaaccacttgaaacacatct |
14655918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University