View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_160 (Length: 222)
Name: NF1242_low_160
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_160 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 42662054 - 42661903
Alignment:
| Q |
1 |
gtgtaatgttacataatcaagcttataaggttttcnnnnnnnactcaatcactgaatcacaagcttataagctgaatattgtgaaaacaattaatgcaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42662054 |
gtgtaatgttacataatcaagcttataaggttttctttttttactcaatcactgaatcacaagcttataagctgaatattgtgaaaacaattaatgcaca |
42661955 |
T |
 |
| Q |
101 |
ctaattgtttcaaataataagtaaatcatagatatcatattattggacatgc |
152 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
42661954 |
ctcattgtttcaaataataagtaaatcatagatatcattttattgggcatgc |
42661903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 55641693 - 55641542
Alignment:
| Q |
1 |
gtgtaatgttacataatcaagcttataaggttttcnnnnnnnactcaatcactgaatcacaagcttataagctgaatattgtgaaaacaattaatgcaca |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
55641693 |
gtgtaatgttacataatcaagcttacaaggttttctttttttactcaatcactgaatcacaagcttataagctgaatattgtgaaaacaattcatgcaca |
55641594 |
T |
 |
| Q |
101 |
ctaattgtttcaaataataagtaaatcatagatatcatattattggacatgc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
55641593 |
ctaattgtttcaaataataagtaaatcatagatatcattttattgggcatgc |
55641542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University