View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_164 (Length: 217)
Name: NF1242_low_164
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_164 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 167
Target Start/End: Complemental strand, 22841885 - 22841736
Alignment:
| Q |
18 |
agaaagattgctcaacattcaacaaatatgtcaaaaactgtattttatagctgtcaatcccgagtaaattgcctcctgatttacctccatctccgggcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22841885 |
agaaagattgctcaacattcaacaaatatgtcaaaaactgtattttatagctgtcaatcccgagtaaattgcctcctgatttacctccatctccgggcaa |
22841786 |
T |
|
| Q |
118 |
cttgccagcacatatgaccgatggaacaggctgacttgaaatgacctatg |
167 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
22841785 |
cttgccagcacatatgaccgacggaacaggctgacttgaaatggcctatg |
22841736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 36 - 160
Target Start/End: Complemental strand, 22877406 - 22877282
Alignment:
| Q |
36 |
tcaacaaatatgtcaaaaactgtattttatagctgtcaatcccgagtaaattgcctcctgatttacctccatctccgggcaacttgccagcacatatgac |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
22877406 |
tcaacaaatatgtcaaaaactgtattttatagctgtcaatcccaagtaaattgcctcgtgatttacctccaattccccgcaacttgccagcacatatgac |
22877307 |
T |
|
| Q |
136 |
cgatggaacaggctgacttgaaatg |
160 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
22877306 |
cgatggaacaggctgacttgaaatg |
22877282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 39 - 154
Target Start/End: Complemental strand, 22895163 - 22895048
Alignment:
| Q |
39 |
acaaatatgtcaaaaactgtattttatagctgtcaatcccgagtaaattgcctcctgatttacctccatctccgggcaacttgccagcacatatgaccga |
138 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
22895163 |
acaaatatgtcaaaaactgaattttatagttgtcaatcctgagtaaattgcctcgtgatttacctccatctccctgcaacttgccagcacatatgaccaa |
22895064 |
T |
|
| Q |
139 |
tggaacaggctgactt |
154 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
22895063 |
tgaaacaggctgactt |
22895048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 51 - 145
Target Start/End: Complemental strand, 22886914 - 22886820
Alignment:
| Q |
51 |
aaaactgtattttatagctgtcaatcccgagtaaattgcctcctgatttacctccatctccgggcaacttgccagcacatatgaccgatggaaca |
145 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| || |||||| ||||||||||| |||| |||||| ||||| |||||||||||||| |
|
|
| T |
22886914 |
aaaattgtattttatagctgtcaatcacgagtaaattacccggtgatttgcctccatctccctgcaatttgccaacacatgtgaccgatggaaca |
22886820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University