View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_166 (Length: 209)
Name: NF1242_low_166
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_166 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 23 - 125
Target Start/End: Original strand, 43013886 - 43013988
Alignment:
| Q |
23 |
gtatgcttgagaattattttttccaaattttaatttctacatgatcatagtctgtgctcatgtctttcttgcatcatccaattttcttaatatttttatt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43013886 |
gtatgcttgagaattattttttccaaattttaatttctacatgatcatagtctgtgctcatgtctttcttgcatcatccaatattcttaatatttttatt |
43013985 |
T |
 |
| Q |
123 |
gat |
125 |
Q |
| |
|
||| |
|
|
| T |
43013986 |
gat |
43013988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University