View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1242_low_166 (Length: 209)

Name: NF1242_low_166
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1242_low_166
NF1242_low_166
[»] chr8 (1 HSPs)
chr8 (23-125)||(43013886-43013988)


Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 23 - 125
Target Start/End: Original strand, 43013886 - 43013988
Alignment:
23 gtatgcttgagaattattttttccaaattttaatttctacatgatcatagtctgtgctcatgtctttcttgcatcatccaattttcttaatatttttatt 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
43013886 gtatgcttgagaattattttttccaaattttaatttctacatgatcatagtctgtgctcatgtctttcttgcatcatccaatattcttaatatttttatt 43013985  T
123 gat 125  Q
    |||    
43013986 gat 43013988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University