View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_173 (Length: 208)
Name: NF1242_low_173
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_173 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 9503419 - 9503301
Alignment:
| Q |
1 |
gtactcatgagtcatgcccccacatatcctcc-actgtaatggacatttacataactattaactaatttgatgagtatcctcgtgtgattattgactaga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9503419 |
gtactcatgagtcatgcccccacatatcctcccactataatggacatttacataactattaactaatttgatgagtatcctcgtatgattattgactaga |
9503320 |
T |
 |
| Q |
100 |
catgtgatacttgtaatga |
118 |
Q |
| |
|
||||| |||||||| |||| |
|
|
| T |
9503319 |
catgtaatacttgtgatga |
9503301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University