View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_177 (Length: 205)
Name: NF1242_low_177
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_177 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 52621656 - 52621792
Alignment:
| Q |
1 |
taaggatggtaaatgaactaatgatgtatctctcaaaaactctcgtgcatctatctttccgttatttcctctcaatgcccatttcacttgattcaacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52621656 |
taaggatggtaaatgaactaatgatgtatctctcaaaaactctcgtgcatctatctttccgttatttcctctcagtgcccatttcacttgattcaacatt |
52621755 |
T |
 |
| Q |
101 |
atttatttgtttcttcactctatcattcttttctctc |
137 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52621756 |
gtttatttgtttcttcactctatcgttcttttctctc |
52621792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University