View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1242_low_177 (Length: 205)

Name: NF1242_low_177
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1242_low_177
NF1242_low_177
[»] chr1 (1 HSPs)
chr1 (1-137)||(52621656-52621792)


Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 52621656 - 52621792
Alignment:
1 taaggatggtaaatgaactaatgatgtatctctcaaaaactctcgtgcatctatctttccgttatttcctctcaatgcccatttcacttgattcaacatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
52621656 taaggatggtaaatgaactaatgatgtatctctcaaaaactctcgtgcatctatctttccgttatttcctctcagtgcccatttcacttgattcaacatt 52621755  T
101 atttatttgtttcttcactctatcattcttttctctc 137  Q
     ||||||||||||||||||||||| ||||||||||||    
52621756 gtttatttgtttcttcactctatcgttcttttctctc 52621792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University