View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_179 (Length: 204)
Name: NF1242_low_179
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_179 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 6287105 - 6286981
Alignment:
| Q |
1 |
tgatcccatgagttatatgttggatttatttagagctattgctctcatacatgcttacaagttacaaccaccacaccaaagcatattgcactttatgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6287105 |
tgatcccatgagttatatgttggatttatttagagctattgctctcatacatgcttacaagttacaaccaccacgccaaagcatattgcactttatgtga |
6287006 |
T |
|
| Q |
101 |
gtaatatgtttgatttatatagaat |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6287005 |
gtaatatgtttgatttatatagaat |
6286981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University