View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_181 (Length: 204)
Name: NF1242_low_181
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_181 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 44953475 - 44953575
Alignment:
| Q |
1 |
cactacaatgtcactttaaatgcaaaaaatttataacatggtcatttacaacataacataatcatgtcaaagtcataaaataattatcacagtatcataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44953475 |
cactacaatgtcactttaaatgcaaaaaatttataacatggtcatttacaacataacatagtcatgtcaaagtcataaaataattatcacagtatcataa |
44953574 |
T |
|
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
44953575 |
c |
44953575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University