View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_27 (Length: 433)
Name: NF1242_low_27
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 83 - 337
Target Start/End: Original strand, 54967968 - 54968222
Alignment:
| Q |
83 |
cataggtatgctagtttaaggatggtagtgttaaaatgctgtttcttcaattcatgaggtaatgactagtgttgaaaagcgatggtaatgatggattgct |
182 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54967968 |
cataagtatgctagtttaaggatggtagtgttaaaatgttgtttcttcaattcatgaggtaatgactagtgttgaaaagcgatggtaatgatggattgct |
54968067 |
T |
|
| Q |
183 |
gtttcttcaattcaggaggttaggaaaggtggcggctatcttctagtagcaacagatgtagcagctagaggagttgactttccagaaatgactcacatat |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54968068 |
gtttcttcaattcaggaggttaggaaaggtggcggctatcttctagtagcaacagatgtagcagctagaggagttgactttccagaaatgactcacatat |
54968167 |
T |
|
| Q |
283 |
acaactttgatctgccaaaaactgccatagattatcttcatcgagcagggaggac |
337 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54968168 |
acaactatgatctgccaaaaactgccatagattatcttcatcgagcagggaggac |
54968222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University