View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1242_low_39 (Length: 389)

Name: NF1242_low_39
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1242_low_39
NF1242_low_39
[»] chr1 (2 HSPs)
chr1 (244-376)||(1270673-1270805)
chr1 (94-160)||(1270523-1270589)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 244 - 376
Target Start/End: Original strand, 1270673 - 1270805
Alignment:
244 gataggtacactgcaaggacgttgtagtagaacatggagatgtatccaaagctttaattgaatatacttctcaatcagcaattgagcatttggttctagg 343  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1270673 gataggtacactgcaaggacgttgtagtagaacatggagatgtatgcaaagctttaattgaatatacttctcaatcagcaattgagcatttggttctagg 1270772  T
344 ctgttccaacaaaaatggttttctcaagtattc 376  Q
    |||||||||||||||||||||||||||||||||    
1270773 ctgttccaacaaaaatggttttctcaagtattc 1270805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 94 - 160
Target Start/End: Original strand, 1270523 - 1270589
Alignment:
94 catatcgtgtcttttgtgcgcgaaaagatgtaagtttcacnnnnnnnccaggatagaaaacaagagg 160  Q
    ||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||    
1270523 catatcgtgtcttttgtgcgcgaaaagatgtaagtttcacttttttcccaggatagaaaacaagagg 1270589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University