View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_44 (Length: 362)
Name: NF1242_low_44
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 97 - 351
Target Start/End: Complemental strand, 39394607 - 39394353
Alignment:
| Q |
97 |
cttattatgttctagctgttttgtttgcatcaccaatgtatcaaacaaattggcttctgattcttttcttttttccaattctgcctctgattcttgaagt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39394607 |
cttattatgttctagctgttttgtttgcatcaccaatgtatcaaacaaattggcttctgattcttttcttttttccaattctgcctctgattcttgaagt |
39394508 |
T |
 |
| Q |
197 |
ttcctcttgtactcagacaacaaatcatctttctccgacaattgttgttcatgttttaatgatatttcactatggttgttttttggttctgaaaccttct |
296 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39394507 |
ttcctcttgtactcagacaacaaaacatctttctccgacaattgttgttcatgttttaatgatatttcactatggttgttttttggttctgaaaccttct |
39394408 |
T |
 |
| Q |
297 |
ttgcggcaattacttcatcaatcatgtcattggttttctctgctacctttttcat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39394407 |
ttgcggcaattacttcatcaatcatgtcattggttttctcagctacctttttcat |
39394353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University