View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_48 (Length: 357)
Name: NF1242_low_48
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 42 - 341
Target Start/End: Original strand, 41781634 - 41781932
Alignment:
| Q |
42 |
aatgtaacaaaattttgtacaacataaaatgctggnnnnnnntgtgcctaattgtctaattcagattaagattacatttcataaattcatagcatcataa |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41781634 |
aatgtaacaaaattttgtacaacataaaatgctggaaaaaaatgtgccgaattgtctaattcagattaagattacatttcataaattcatagcatcataa |
41781733 |
T |
 |
| Q |
142 |
caactagtaccatttgattggaatttattgtttgtacatatatcctctagattcgattgtgatgtttttgaaactggaattttatgttgccttttctatg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41781734 |
caactagtaccatttgattggaatttattgtttgtacatatatcctctagattcgattgtgatgtttttgaaactggaattttatgttgccttttctatg |
41781833 |
T |
 |
| Q |
242 |
tttctcttcttgttatgatttatcaatgttgttgctttttcttcccccctttatttacaagttgtttttattttgaccaagttgagtttgttagattcat |
341 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41781834 |
tttctcttcttgttgtgatttatcaatgttgttgctttttcttcccccctttatttacaagttg-ttttattttgaccaagttgagtttgttagattcat |
41781932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University