View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_53 (Length: 342)
Name: NF1242_low_53
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_53 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 29 - 342
Target Start/End: Original strand, 38520328 - 38520641
Alignment:
| Q |
29 |
atttttcattccaaagataatcagtaaagttaattacatcttaaaacattagttattaccagattattttgaaactcaaaatcatactagtaagtggcag |
128 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38520328 |
atttttcattccaaagctaatcagtagagttaattacatcttaaaacattagttattaccagattattttgaaactcaaaatcatactagtaagtggcag |
38520427 |
T |
 |
| Q |
129 |
attttccttcaaaaaatagttgtggaaaaatataccatatttattaatccctctataatttccgcaattttgtttatcttcttttttcttataaatcaag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38520428 |
attttccttcaaaaaatagttgtggaaaaatataccatatttattaatccctctataatttccgcaattttgtttatcttcttttttcttataaatcaag |
38520527 |
T |
 |
| Q |
229 |
attaaattgttttttcttcactcgtatgacaatttctttcaccatatattctagttaaatagatttttgactcacctaatcccccctctttctccaacac |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38520528 |
attaaattgttttttcttcactcgtatgacaatttctttcaccatataatctagttaaatagatttttgactcacctaatcccccctctttctccaacac |
38520627 |
T |
 |
| Q |
329 |
tttttcatagatga |
342 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38520628 |
tttttcatagatga |
38520641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University