View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_57 (Length: 334)
Name: NF1242_low_57
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 21 - 307
Target Start/End: Complemental strand, 2413405 - 2413119
Alignment:
| Q |
21 |
accacagatgaaagaagcaagagctgcaattcgccacgcgacagattatctcctcaaatgtgcaacatcaacacctggaagactctatgttggtgttgga |
120 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2413405 |
accacaaatgaaagaagcaagagctgcaattcgccacgcgacagattatctcctcaaatgtgcaacatcaacacctggaagactctatgttggtgttgga |
2413306 |
T |
 |
| Q |
121 |
gatccaaatgttgatcacaaatgttgggaaagaccagaagatatggacactgttagaactgtttattacgtatcttcaaagaatcctggttctgatgttg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
2413305 |
gatccaaatgttgatcacaaatgttgggaaagaccagaagatatggacactgttagaactgtttatttcgtatcttcaaagaatcccggttctgatgttg |
2413206 |
T |
 |
| Q |
221 |
ccgctgaaaccgctgctgcacttgctgcggcgtctattgtttttagaaaagttgatccaacttattctaagcttttgttgaggactg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2413205 |
ccgctgaaaccgctgctgcacttgctgcggcgtctattgtttttagaaaagttgatccaacttattctaagcttttgttgaggactg |
2413119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University