View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_58 (Length: 332)
Name: NF1242_low_58
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_58 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 102 - 332
Target Start/End: Original strand, 27626412 - 27626642
Alignment:
| Q |
102 |
gatcctaaagccgttgatcggatttctactcttactatggctgctggtgttcttggtgttgctaggtacttcattttcccttttgcttttctttcctttc |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27626412 |
gatcctaaagctgttgatcggatttctactcttactatggctgctggtgttcttggtgttgctaggtacttcattttcccttttgcttttctttcctttc |
27626511 |
T |
|
| Q |
202 |
caagcttcctttattactagttgattgaatgctttattgctaaaccaagtttttagtgttcatatggattcaatgagtttgacaaattcacagcgtattc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27626512 |
caagcttcctttattactagttgattgaatgctttattgctaaaccaagtttttagtgttcatatggattcaatgagtttgacaaattcacagcgtattc |
27626611 |
T |
|
| Q |
302 |
gtaattttgtaaaagctacattttgaagatt |
332 |
Q |
| |
|
|||||||||||||||||||| | |||||||| |
|
|
| T |
27626612 |
gtaattttgtaaaagctacactctgaagatt |
27626642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University